Cell tradition
The human B-ALL cell strains Reh and Nalm-6 had been obtained from Procell Life Science& Expertise Co., Ltd (Wuhan, China) and cultured in 1640 RPMI medium (11875093, Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS, A3161002C, Gibco) and 1% penicillin/streptomycin (C100C5, New Cell & Molecular Biotech, Suzhou, China). The 293T cell line was maintained in DMEM media (11965092, Gibco) containing 10% FBS and 1% P/S. All cell strains had been incubated at 37 °C in a humidified incubator with 5% CO2. Authentication of the cell strains was commonly carried out utilizing quick tandem repeat (STR) matching evaluation. To ascertain Reh-6-MP resistant (Reh-6-MPR) and Nalm-6-6-MPR cell strains, the parental Reh and Nalm-6 cells had been uncovered to 6-MP (HY-13677, MedChemExpress, Shanghai, China) at preliminary concentrations of 0.5 and 0.25 μg/mL, respectively. After culturing for 48 h, the cells had been transferred to a contemporary full medium for a further 72 h. The method was repeated, and the cells had been passaged utilizing gradient-increasing concentrations of 6-MP (0.25 μg/mL –0.5 μg/mL –1 μg/mL –2 μg/mL –4 μg/mL –8 μg/mL –16 μg/mL). The drug-resistant cell strains had been efficiently established till the cells doubled stably within the medium with 16 μg/mL 6-MP. Earlier than experiments, 6-MP resistant cells can be cultured within the 6-MP-free medium for a minimum of 2 weeks.
Affected person samples
Human bone marrow samples of pediatric sufferers with B-ALL had been collected from Qilu Hospital of Shandong College (Supplementary Tables 1, 2; Jinan, China). Mononucleated cells had been remoted utilizing a Ficoll gradient centrifugation methodology. These main cells had been cultured in RPMI-1640 medium supplemented with 20% FBS and 1% P/S. The protocols on this examine had been reviewed and authorised by the Ethics Committee of Scientific Analysis of Shandong College Qilu Hospital (KYLL-202306-053) following the tenets of the Declaration of Helsinki. Written knowledgeable consent was obtained from all contributors.
Actual-time quantitative PCR (RT-qPCR)
Complete RNA was extracted utilizing Trizol reagent (15596018, Invitrogen, Carlsbad, CA, USA) or RNA quick assay Package (220011, Fastagen, Shanghai, China), adopted by reverse transcription to cDNA utilizing the ReverTraAce qPCR RT Grasp Combine package (FSQ-201, TOYOBO, Osaka, Japan). Quantitative real-time PCR amplification was carried out utilizing SYBR Inexperienced Realtime PCR Grasp Combine (QPK-201, TOYOBO) on a Actual-Time Thermocycler (qTOWER3G, Analytik Jena AG, Germany), in keeping with the producer’s directions. Relative fold modifications had been calculated utilizing the comparative Ct methodology (2−ΔΔCt), with endogenous β-actin serving as a reference gene. All oligonucleotide primers had been synthesized by Biosune Biotech (Shanghai, China), and their sequences are listed in Supplementary Desk 3.
Cell viability assays
Cells had been seeded in 96-well plates and handled with totally different doses of 6-MP and histidine (199604, J&Okay Chemical, Shanghai, China), individually or collectively. After 48 h of tradition, Cell Counting Package-8 reagent (CCK-8; C6005, New Cell & Molecular Biotech) was added at a quantity of 10 μL per properly and incubated for a further 4 h. The optical density worth at 450 nm was then measured utilizing a spectrophotometer (Perlong, Beijing, China). Drug sensitivity curves and IC50 had been calculated via best-fit evaluation of log drug focus knowledge utilizing GraphPad Prism software program model 8.0.
Colony formation assay
The handled cells had been suspended within the full methylcellulose-based medium (038818 and 04434, Stem Cell Applied sciences, Vancouver, Canada) and planted right into a 12-well plate at a density of roughly 2000–3000 cells/properly for Reh-6-MPR and 1 × 104 cells/properly for Nalm-6-6-MPR. Following a tradition interval of 10 to 14 days at 37 °C and 5% CO2, colonies consisting of ≥50 cells had been manually counted below an inverted microscope (Olympus Tokyo, Japan).
Cell siRNA and plasmid transfection
The siRNA sequences focusing on SIRT5 had been as follows: siSIRT5-1, CGUCCACACGAAACCAGAUUU; siSIRT5-2, GAGUCCAAUUUGUCCAGCU. The siRNA was diluted in Opti-MEM (31985070, Gibco) and transfected into cells utilizing Lipofectamine 2000 (11668019, Invitrogen) at a closing focus of 80 nmol/L following the producer’s directions. The Flag-SIRT5-WT, Flag-SIRT5-H158Y, GFP-HINT1, and respective adverse management plasmids had been obtained from Miaoling Biology (Wuhan, China) and transfected into 6-MP-resistant leukemia cells with a DNA(μg): lipofectamine 2000 (μL) ratio of 1:2.5. For 293T cells, polyethylenimine (PEI; HY-W250110, MedChemExpress) was employed for plasmids transfection.
Lentivirus an infection
The shSIRT5 lentivirus was packaged by GeneChem Co. (Shanghai, China) utilizing U6-MCS-Ubiquitin-mCherry-puromycin vector and added to Reh-6-MPR and Nalm-6-6-MPR cells at a multiplicity of an infection (MOI) of 60 with HiTrans G (GeneChem Co.). Positively contaminated cells had been chosen with puromycin (1 μg/mL; ST551, Beyotime, Shanghai, China).
In vivo experiment
Six to eight-week-old male M-NSG mice (NOD.Cg-PrkdcscidIl2rgem1Smoc) had been obtained from Shanghai Mannequin Organisms Heart, Inc. (Shanghai, China). All animal procedures had been licensed by the Institutional Animal Care and Use Committee of Shandong College Qilu Hospital (DWLL-2023-069). To ascertain the murine xenograft mannequin of human B-ALL, secure SIRT5-knockdown and management Nalm-6-6-MPR cell strains carrying mCherry fluorescence had been transplanted into M-NSG mice intravenously at a dosage of 5 × 106 cells/per mouse. Peripheral blood was collected each 3–4 days to watch the leukemic development. Subsequently, 7-day therapy was initiated after detecting greater than 1% of human CD19+ cells in peripheral blood. For the in vivo experiment depicted in Fig. 2 and Fig. S2, mice had been randomly assigned to one among 4 teams by easy randomization methodology and handled with PBS (100 μL), histidine (60 mg/kg/day), 6-MP (5 mg/kg/day), or a mixture of histidine and 6-MP by way of tail vein injection. For the animal experiment illustrated in Fig. 6 and Fig. S6, mice had been subjected to PBS (100 μL), histidine (60 mg/kg/day) + 6-MP (5 mg/kg/day), or THF (10 mg/kg/day) + histidine + 6-MP via intravenous administration. Leukemia burden was quantified by detecting mCherry fluorescence sign utilizing IVIS spectrum (PerkinElmer, Massachusetts, USA) on the endpoint of therapy. Spleen weight was measured as an indicator of leukemic organ infiltration. Moreover, therapy response was decided by circulation cytometric evaluation of human CD19+ cells amongst mononucleated cells remoted from the peripheral blood, bone marrow, and spleen samples.
Movement cytometry evaluation
For apoptotic cell dedication, samples had been washed with chilly PBS adopted by staining with FITC-Annexin V/propidium iodide (556547, BD Biosciences), or PE-Annexin V/7-Amino-Actinomycin (559763, BD Biosciences) following the producer’s directions. Cell cycle distribution was examined utilizing propidium iodide (PI; 550825, BD Biosciences) staining. The EdU Cell Proliferation Package with Alexa Fluor 488 or 647 (CX002 and CX004, CellorLab, Shanghai, China) was utilized to evaluate the proliferation capability of Reh-6-MPR and Nalm-6-6-MPR cells. The circulation cytometry evaluation offered within the examine was carried out with the Guava easyCyte 6HT (Millipore, MA, USA), and the information had been evaluated utilizing the Guava Incyte software program (Millipore) and Flowjo v10 software program.
LC-MS evaluation of intracellular metabolites
The intracellular metabolite was extracted from 5 × 106 handled cells utilizing ice-cold 80% methanol containing 0.5% ascorbic acid (1043003, Merck, Darmstadt, Germany) and 0.5% 2-mercaptoethanol (BME; 21985-023, Gibco). After thorough mixing by vortexing on ice and centrifugation at 16,000×g for 15 min at 4 °C, the supernatant was transferred to a brand new tube and dried utilizing the Built-in SpeedVac System (Thermo Fisher, Waltham, MA, USA). For metabolites profiling, the dried samples had been resuspended in 200 μL of an answer containing 0.1% formic acid (5330020050, Merck) and loaded onto a C18 HPLC column (2.2 μm particle measurement, 2.1 × 100 mm, Thermo Fisher), which was coupled on-line to Dionex UltiMate 3000 UPLC system (Thermo Fisher) working in full-scanned optimistic electrospray ionization mode. The cell section was composed of 0.1% formic acid (buffer A) and acetonitrile (51101, Thermo Fisher) containing 0.1% formic acid (buffer B). The circulation fee was set at 0.4 mL/min with the next gradient: 0–5 min, held at 5% B; 5–10 min, a linear enhance from 5 to twenty% of B; 10.1–14.0 min, linear gradient from 36 to 95% B; 14.1–18.0 min, the gradient was introduced again to preliminary circumstances and maintained [19]. Relative quantitation of intracellular metabolites was carried out utilizing Compass DataAnalysis 4.4 (Bruker, Bremen, Germany) with a 20ppm mass tolerance.
RNA-sequencing and evaluation
Reh-6-MPR cells had been handled with PBS, histidine (4 mM), 6-MP (1.0 μg/mL), or a mixture of histidine and 6-MP for 48 h, after which instantly collected with Trizol reagent (Invitrogen) for whole RNA extraction. The collected samples had been then commissioned to sequence, quantify, and analyzed by Xiuyue Biol (Jinan, China). Differentially expressed genes (DEGs) had been recognized utilizing DESeq2, with standards of absolute log2 fold change ≥1 and adjusted P worth <0.05. The unique knowledge can be found within the GEO repository below the accession quantity GSE236934.
Western blot
The cell lysates had been separated by way of sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes (ISEQ00010, Millipore). Subsequently, the membranes had been blocked with 5% skimmed milk and incubated in a single day at 4 °C with main antibodies. The next antibodies had been used: anti-SIRT5 (1:1000 dilution; 8782 S, Cell Signaling Expertise, Danvers, MA, USA), anti-HINT1 (1:1000 dilution; 67583-1-Ig, Proteintech, Rosemont, IL, USA), anti-Succinyllysine (1:1000 dilution; PTM-401, PTM Bio, Hangzhou, China), anti-Acetyllysine (1:500 dilution; PTM-105RM, PTM Bio), anti-GFP (1:5000 dilution; 50430-2-AP, Proteintech), anti-Flag (1:5000 dilution; 80010-1-RR, Proteintech), and anti-β-Actin (1:5000 dilution; AB0035, Abways, Shanghai, China). Then PVDF membranes had been incubated with HRP-conjugated goat anti-rabbit or mouse antibodies (1:5000 dilution; AB0101 and AB0102, Abways) and totally washed. The protein bands had been visualized utilizing the ECL chemiluminescence detection package (WBKLS0500, Millipore), and band depth was quantified utilizing ImageJ software program.
Immunoprecipitation (IP) and Co-IP
Cells had been lysed with 1% NP-40 buffer (P0013F, Beyotime) with freshly added proteinase and phosphatase inhibitor cocktail. Then the lysate was incubated with Flag Fab-Lure™ Agarose (ffa, Chromotek, Proteintech) or Anti-GFP Beads (L-1016, Biolinkedin, Shanghai, China) with light rotation in a single day at 4 °C. The captured complexes had been washed, boiled at 95 °C in SDS pattern buffer, and detected by SDS-PAGE. To research the SIRT5-interacting proteins, the gels had been stained with coomassie good blue (CBB) and lower for mass spectrometry evaluation, which was carried out by PTM Bio. The interplay between HINT1 and SIRT5, in addition to the acetylation or succinylation of HINT1, had been additional validated by Western blot utilizing corresponding antibodies.
Statistical evaluation
Earlier than conducting comparisons, the quantitative knowledge had been examined for normality utilizing the Kolmogorov–Smirnov check, adopted by the variance homogeneity check utilizing the Bonferroni check. Statistical evaluation was carried out utilizing GraphPad Prism 8.0.1 and outcomes are represented as imply ± SEM. An unpaired two-tailed t-test was carried out to research the variations between the 2 teams. One-way evaluation of variance (ANOVA) with Dunnett’s check was carried out to check amongst a number of homogeneous teams. Comparisons of grouped knowledge had been calculated utilizing two-way ANOVA with Tukey’s check. Nonparametric Spearman’s correlation evaluation was carried out to create correlation matrices. Outcomes with P values lower than 0.05 had been thought-about statistically important. The number of pattern measurement was primarily based on intensive earlier research. No knowledge was excluded from the examine.
